ID: 1122352374

View in Genome Browser
Species Human (GRCh38)
Location 14:101103568-101103590
Sequence CCAGAGGCAGGGAGCGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352374_1122352388 30 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352388 14:101103621-101103643 AGGCACCATCTTCCCACTCAGGG No data
1122352374_1122352381 -3 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352381 14:101103588-101103610 TGGCCAGCTCAGGCTGTGTGTGG No data
1122352374_1122352387 29 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352387 14:101103620-101103642 AAGGCACCATCTTCCCACTCAGG No data
1122352374_1122352382 -2 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352382 14:101103589-101103611 GGCCAGCTCAGGCTGTGTGTGGG No data
1122352374_1122352385 6 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG No data
1122352374_1122352383 -1 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352383 14:101103590-101103612 GCCAGCTCAGGCTGTGTGTGGGG No data
1122352374_1122352386 10 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352374 Original CRISPR CCAGAGGCAGGGAGCGCCTC GGG (reversed) Intergenic
No off target data available for this crispr