ID: 1122352378

View in Genome Browser
Species Human (GRCh38)
Location 14:101103579-101103601
Sequence GCCTGAGCTGGCCAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352378_1122352386 -1 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352378_1122352388 19 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352388 14:101103621-101103643 AGGCACCATCTTCCCACTCAGGG No data
1122352378_1122352387 18 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352387 14:101103620-101103642 AAGGCACCATCTTCCCACTCAGG No data
1122352378_1122352389 20 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352389 14:101103622-101103644 GGCACCATCTTCCCACTCAGGGG No data
1122352378_1122352385 -5 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352378 Original CRISPR GCCTGAGCTGGCCAGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr