ID: 1122352380

View in Genome Browser
Species Human (GRCh38)
Location 14:101103584-101103606
Sequence ACACAGCCTGAGCTGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352380_1122352389 15 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352389 14:101103622-101103644 GGCACCATCTTCCCACTCAGGGG No data
1122352380_1122352392 26 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352392 14:101103633-101103655 CCCACTCAGGGGTTGCACCGCGG No data
1122352380_1122352395 28 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352395 14:101103635-101103657 CACTCAGGGGTTGCACCGCGGGG No data
1122352380_1122352396 29 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352396 14:101103636-101103658 ACTCAGGGGTTGCACCGCGGGGG No data
1122352380_1122352394 27 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352394 14:101103634-101103656 CCACTCAGGGGTTGCACCGCGGG No data
1122352380_1122352385 -10 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG No data
1122352380_1122352386 -6 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352380_1122352387 13 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352387 14:101103620-101103642 AAGGCACCATCTTCCCACTCAGG No data
1122352380_1122352388 14 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352388 14:101103621-101103643 AGGCACCATCTTCCCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352380 Original CRISPR ACACAGCCTGAGCTGGCCAG AGG (reversed) Intergenic
No off target data available for this crispr