ID: 1122352386

View in Genome Browser
Species Human (GRCh38)
Location 14:101103601-101103623
Sequence CTGTGTGTGGGGCATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352370_1122352386 23 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352373_1122352386 13 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352376_1122352386 9 Left 1122352376 14:101103569-101103591 CCGAGGCGCTCCCTGCCTCTGGC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352379_1122352386 -2 Left 1122352379 14:101103580-101103602 CCTGCCTCTGGCCAGCTCAGGCT No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352378_1122352386 -1 Left 1122352378 14:101103579-101103601 CCCTGCCTCTGGCCAGCTCAGGC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352371_1122352386 18 Left 1122352371 14:101103560-101103582 CCAGCCCACCCGAGGCGCTCCCT No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352374_1122352386 10 Left 1122352374 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352372_1122352386 14 Left 1122352372 14:101103564-101103586 CCCACCCGAGGCGCTCCCTGCCT No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data
1122352380_1122352386 -6 Left 1122352380 14:101103584-101103606 CCTCTGGCCAGCTCAGGCTGTGT No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352386 Original CRISPR CTGTGTGTGGGGCATGTGGA AGG Intergenic
No off target data available for this crispr