ID: 1122353716

View in Genome Browser
Species Human (GRCh38)
Location 14:101111580-101111602
Sequence GTTGCTATTTAAAGGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122353716_1122353726 5 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353726 14:101111608-101111630 TGGGGCCAAGGGGGACTGACGGG No data
1122353716_1122353723 -5 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353723 14:101111598-101111620 GCAACAGTCATGGGGCCAAGGGG No data
1122353716_1122353725 4 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353725 14:101111607-101111629 ATGGGGCCAAGGGGGACTGACGG No data
1122353716_1122353729 14 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353729 14:101111617-101111639 GGGGGACTGACGGGAGCTGAGGG No data
1122353716_1122353728 13 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353728 14:101111616-101111638 AGGGGGACTGACGGGAGCTGAGG No data
1122353716_1122353721 -7 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353721 14:101111596-101111618 TAGCAACAGTCATGGGGCCAAGG No data
1122353716_1122353724 -4 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353724 14:101111599-101111621 CAACAGTCATGGGGCCAAGGGGG No data
1122353716_1122353722 -6 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353722 14:101111597-101111619 AGCAACAGTCATGGGGCCAAGGG No data
1122353716_1122353732 21 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353732 14:101111624-101111646 TGACGGGAGCTGAGGGGCGCGGG No data
1122353716_1122353731 20 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353731 14:101111623-101111645 CTGACGGGAGCTGAGGGGCGCGG No data
1122353716_1122353730 15 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353730 14:101111618-101111640 GGGGACTGACGGGAGCTGAGGGG No data
1122353716_1122353733 22 Left 1122353716 14:101111580-101111602 CCAAGATGCCTTTAAATAGCAAC No data
Right 1122353733 14:101111625-101111647 GACGGGAGCTGAGGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122353716 Original CRISPR GTTGCTATTTAAAGGCATCT TGG (reversed) Intergenic
No off target data available for this crispr