ID: 1122355551

View in Genome Browser
Species Human (GRCh38)
Location 14:101121033-101121055
Sequence GAGGGTCACCAGGAAGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122355551_1122355554 -6 Left 1122355551 14:101121033-101121055 CCGTGCACTTCCTGGTGACCCTC 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1122355554 14:101121050-101121072 ACCCTCTGAGACAACTTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 147
1122355551_1122355560 30 Left 1122355551 14:101121033-101121055 CCGTGCACTTCCTGGTGACCCTC 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1122355560 14:101121086-101121108 CATGGAGTCAGTGCAAGTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1122355551_1122355559 29 Left 1122355551 14:101121033-101121055 CCGTGCACTTCCTGGTGACCCTC 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1122355559 14:101121085-101121107 TCATGGAGTCAGTGCAAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 126
1122355551_1122355553 -7 Left 1122355551 14:101121033-101121055 CCGTGCACTTCCTGGTGACCCTC 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1122355553 14:101121049-101121071 GACCCTCTGAGACAACTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 117
1122355551_1122355558 12 Left 1122355551 14:101121033-101121055 CCGTGCACTTCCTGGTGACCCTC 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1122355558 14:101121068-101121090 CTGGGCAGAGTTGATCATCATGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122355551 Original CRISPR GAGGGTCACCAGGAAGTGCA CGG (reversed) Intergenic
900142213 1:1143422-1143444 GCGAGTCCCCAGGCAGTGCAGGG - Intergenic
900370101 1:2328448-2328470 TAGGGCCACCAGGATGTGCCGGG + Intronic
900495819 1:2975561-2975583 GAGGGTCTCCAGGAGGGGCCTGG - Intergenic
900888598 1:5432764-5432786 GACGGTCAGCATGAAGTCCATGG - Intergenic
900983008 1:6057298-6057320 CAGGTTCACCAGGAAGTACTTGG + Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901414176 1:9105531-9105553 GAGGGTCAGCACGAACCGCACGG + Exonic
901642374 1:10699195-10699217 GAGGATGAGCTGGAAGTGCAGGG - Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
904663348 1:32101517-32101539 GGGGGTGAGCAGGAAGTGAAGGG - Intronic
904674440 1:32190107-32190129 CAGTGTCACCTGGAAGTGCGAGG - Exonic
905313529 1:37066629-37066651 GATGGTGACCAGGAAGGGCAGGG + Intergenic
905440048 1:37989869-37989891 GATGCTCACCAAGAAGTCCACGG - Exonic
905562916 1:38941607-38941629 GGGCGGCAGCAGGAAGTGCAGGG - Intronic
906771891 1:48492554-48492576 CAGTGTCACCAGGAAGCACAAGG - Intergenic
907710206 1:56873730-56873752 GAGAGGCACCAGGAAATACAGGG + Intronic
907722463 1:56984531-56984553 GAGGGTCACAAGGGAGTGTAAGG + Intergenic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
913093920 1:115498469-115498491 GAGGGTAACCAGGTTGGGCAGGG - Intergenic
917153168 1:171966115-171966137 GAGGGCCACCTGGGAGGGCAAGG - Intronic
919983617 1:202657941-202657963 GAGGGTCCCCAGGAAGGGGCTGG - Intronic
920646442 1:207807446-207807468 GGGGGGCACCAGGAAGCCCAGGG + Intergenic
920969325 1:210729453-210729475 GAGGGCCACCTGGCAATGCATGG - Intronic
921893996 1:220380068-220380090 GAGGGTGGCAGGGAAGTGCAGGG - Intergenic
922718162 1:227887499-227887521 GTGGGTCACCAGGGAGGGGAGGG + Intergenic
923271490 1:232359085-232359107 CAGGGTCCCCAGGAAGGGCCAGG + Intergenic
924040937 1:239983171-239983193 GAGAGCCACCAGGAATTTCAGGG - Intergenic
1063295678 10:4803253-4803275 GAGGAGCACCAGGAAGGGGAAGG + Intronic
1067681784 10:48446174-48446196 GACCCTCACCAGGAACTGCATGG + Intronic
1068259940 10:54566731-54566753 GAGGGTCTACAGTAAGTGAATGG - Intronic
1070590539 10:77797585-77797607 GAGAGTCTCCAGAAAGAGCAGGG + Intronic
1070686688 10:78490046-78490068 GCTGGTCACCAGAAAGTCCAAGG + Intergenic
1071298117 10:84237338-84237360 GAGGTTCTCCAGGAAGCGCGCGG + Exonic
1071574347 10:86715013-86715035 GTGGGTCACCTGGGAGTGGAAGG + Intronic
1071926715 10:90417529-90417551 GAGGCTCACAAGGAATTTCATGG - Intergenic
1072159390 10:92752301-92752323 GAGGATCACCCGGAAGTTCGAGG + Intergenic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1073134750 10:101214260-101214282 GAGGGCCGCAAGGAATTGCAGGG - Intergenic
1075067407 10:119298728-119298750 AAGGGTGTCCAGGAAGTGCGGGG - Intronic
1076111736 10:127865022-127865044 GTGGGTCACCAGAAAGACCAAGG + Intergenic
1077013213 11:388713-388735 GAGGGTTTCCAGACAGTGCAGGG + Intergenic
1077186128 11:1236193-1236215 GAGGCTGGCCAGGAAGTGCTGGG - Intronic
1077664153 11:4093116-4093138 GAGGGTGTCCAGGGAGTACAAGG - Exonic
1077676745 11:4201404-4201426 GAGGCCCGCCAGAAAGTGCAGGG - Intergenic
1078920659 11:15827135-15827157 GCAGGTCACCAGGAAGAGCATGG + Intergenic
1079152789 11:17915931-17915953 GAGGGACAGCAGCAGGTGCAGGG + Intronic
1081562797 11:44234197-44234219 GTTGGCCACCAGGAAGTTCATGG - Exonic
1083324266 11:61865574-61865596 GAGTGGCCCCAGGGAGTGCAAGG - Intronic
1084319441 11:68365310-68365332 GAGGGTGGCCAGGAAGGTCACGG + Intronic
1084872246 11:72106116-72106138 CAGGGTCACCGGGCAGGGCATGG - Exonic
1087535008 11:99431845-99431867 GAGGGTCAAGAGGGAGGGCATGG + Intronic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1089671795 11:120062050-120062072 GAGGGGCAGCAGGAAGTGGTGGG + Intergenic
1089679702 11:120112361-120112383 CAGGGTCAGGAGGAAGAGCAGGG + Exonic
1090556171 11:127878739-127878761 GCTGGTCACCAGGAAGACCAAGG - Intergenic
1090668134 11:128928570-128928592 GAGGGGCACCCGGAAGTGATGGG - Intergenic
1093987725 12:25555912-25555934 GAGGGTCAGCAAGAACTGAAAGG + Intronic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096652196 12:53067372-53067394 GAGGGTCTGCAGGAAGGGCACGG + Intronic
1097074541 12:56383258-56383280 CAGTGTCACCCAGAAGTGCACGG - Intergenic
1101874932 12:108591722-108591744 GAGGGGGACCAGGAAGTCCAGGG - Exonic
1101881983 12:108631943-108631965 TAGGGTCACCACGAACTCCATGG + Exonic
1102027073 12:109719708-109719730 GAGCATGACCAGGAAGGGCAGGG + Intronic
1102211966 12:111133779-111133801 GAGTTTCCCCAGGCAGTGCAGGG + Intronic
1102641883 12:114374075-114374097 GAAGGTCACCAGGAAGTCCTTGG - Intronic
1104940288 12:132391990-132392012 GAGGGTCCCCAGGGAGAGCGGGG - Intergenic
1104940553 12:132392561-132392583 GAGGGTCCCCGGGGAGAGCAGGG - Intergenic
1105790022 13:23789704-23789726 GAGGGTCAACAAGAAGGGCATGG - Intronic
1106699084 13:32209673-32209695 GAGGCTAATCAGGAACTGCAAGG - Exonic
1110256316 13:73437491-73437513 GAGGCTCACCAGGATTTGCTGGG + Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113097762 13:106684021-106684043 GGGGGTCACCAGGAAGTCAGGGG + Intergenic
1113126159 13:106981771-106981793 GAGGGTCAACAGGAAAGGAAAGG - Intergenic
1113321388 13:109235655-109235677 AAGGGTCACCAGGTACTGGAGGG + Intergenic
1113885473 13:113656495-113656517 GCGGGGGCCCAGGAAGTGCAGGG - Intronic
1114773816 14:25458457-25458479 GAGGCTGCCCAGGAAGAGCAAGG - Intergenic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1119424566 14:74527358-74527380 GAGAGTCACCTGGAAGGGAAAGG + Exonic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120005880 14:79357535-79357557 GTGGGTCACCTGGAAGTCAACGG - Intronic
1121336010 14:93077852-93077874 TAGGGCCACCAGGACCTGCAGGG + Intronic
1121996602 14:98607780-98607802 GAGGGACTCCAGGAAGGCCATGG + Intergenic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1122767271 14:104081230-104081252 GAGGGGCAGGAGGAAGTGCCTGG - Intergenic
1202902678 14_GL000194v1_random:52503-52525 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1123438463 15:20272753-20272775 CAGGGACAGCAGGAAGTGAACGG + Intergenic
1124013490 15:25858404-25858426 GAGGCTCACCTGGAAGGGAAGGG + Intronic
1125360924 15:38864256-38864278 GAGAGTCAGTAGGAAGAGCATGG + Intergenic
1126202850 15:46007133-46007155 GCTGGTCACCAGGAAGACCAAGG - Intergenic
1126969939 15:54099420-54099442 GAGGGTCACCTTGAGATGCATGG - Intronic
1127257713 15:57306218-57306240 GAGGGTAAGTAGGAAGCGCAGGG - Intergenic
1128995235 15:72290089-72290111 AAGGGTCACCAGGAAATCCCGGG + Intronic
1129799011 15:78399489-78399511 GAGGGACACGAGGAAGTGGAAGG + Intergenic
1130012632 15:80163458-80163480 CAGGGGCACCAGGAAGTGAGAGG + Intronic
1130125169 15:81087812-81087834 GAGGGAGATCAGAAAGTGCAGGG - Intronic
1131046343 15:89318880-89318902 GAGGGGCCCCAGGGAGGGCAGGG - Intronic
1132381075 15:101367086-101367108 GAGGCTCATCAGGACTTGCAAGG - Intronic
1133154026 16:3859562-3859584 GCTGGTCACCAGGAAGACCAAGG + Intronic
1134186842 16:12091266-12091288 GTGGGTCTCCAGGAACGGCAAGG - Intronic
1136278420 16:29192770-29192792 GGGGGGCACCAGGCAGTGCAGGG + Intergenic
1137019150 16:35406316-35406338 GAGGTTCACCTGAAAGTGCACGG - Intergenic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1137903354 16:52293382-52293404 TGAGGTCACCAGGAAGTGGATGG + Intergenic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1140538464 16:75733071-75733093 GAGGGGCACGAGGAGGTGCAGGG - Intronic
1141196443 16:81865013-81865035 GAGGCTTACTAGGGAGTGCAGGG + Intronic
1141810258 16:86371295-86371317 GAGGGGCAGAAGGAAGGGCAAGG - Intergenic
1142082804 16:88158803-88158825 GGGGGGCACCGGGCAGTGCAGGG + Intergenic
1142119010 16:88376838-88376860 TAGGGCAGCCAGGAAGTGCAGGG + Intergenic
1142282271 16:89154742-89154764 GAGCAGCACCAGGAAATGCACGG - Exonic
1142686242 17:1578385-1578407 GAGGGCCCCCAGGAATTGGAGGG - Intronic
1143103805 17:4518640-4518662 TAGGCTCACGAGGAAGTGCCAGG + Intronic
1143728723 17:8867716-8867738 GAGGGCCACAAGGAAGGGGAAGG - Intergenic
1143746108 17:8995377-8995399 GAGCATTACAAGGAAGTGCAGGG - Intergenic
1146407684 17:32553393-32553415 GTGGCTCACCAGGAAGAGCAGGG + Intronic
1147760258 17:42793564-42793586 GAGGGTCAACAGGATGGGGAGGG - Intronic
1147970757 17:44218452-44218474 GGGGGTCACGAGGAAGAGGAGGG - Intronic
1148455881 17:47811161-47811183 GAGGGTCATCAGCAAGGGCTGGG - Intronic
1148471091 17:47893899-47893921 GAGGATCAGCAGGAAATGTAAGG - Intergenic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1150621156 17:66808628-66808650 GACAGTCACCAGGAAGGACAAGG + Exonic
1151688293 17:75662806-75662828 GCGGGACACCAGGGAGTTCAGGG + Exonic
1151837569 17:76593289-76593311 CAGGGTGCCCAGGAAGGGCATGG + Intergenic
1152099814 17:78294465-78294487 GAGTGTGACCATGAAGAGCAGGG + Intergenic
1152319149 17:79598182-79598204 GAGGGTGACCAACAGGTGCAGGG + Intergenic
1152908495 17:82983722-82983744 CAGGGGCACCAGGCAGGGCAGGG + Intronic
1154163231 18:11995294-11995316 ATGGGACACGAGGAAGTGCAAGG + Intronic
1154410501 18:14138764-14138786 GGGGGTCACCTGAATGTGCATGG + Intergenic
1156401772 18:36745800-36745822 GGGGGTCAGCAGGAAGTGAGCGG - Intronic
1158524217 18:58197856-58197878 GAGGCTCACCAGAAAGTCCTCGG - Intronic
1159327267 18:66938442-66938464 GTGGGTCAACAGGAAGCGGATGG - Intergenic
1160522805 18:79518472-79518494 AAGGTCCACCAGGAAGTGCCTGG + Intronic
1160949718 19:1659633-1659655 GAGGGTGAGCAGGAGGTGCTGGG + Intergenic
1162591680 19:11596404-11596426 CAAGGTCACCAGTATGTGCAGGG - Intronic
1162811105 19:13164676-13164698 AAGGGTTAACAGGAAGTGCCTGG - Intergenic
1164528303 19:29027828-29027850 GAGGCGCACCAGGGAGTGCAGGG + Intergenic
1164770096 19:30801775-30801797 GAGAGGCACCAGCAAGTGCAGGG - Intergenic
1168405312 19:56107588-56107610 GAGGGTCACCAGGAGGGCCGAGG + Intronic
1168451227 19:56468032-56468054 GTTGGTCACCAGGAAGACCAAGG - Intronic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
927516106 2:23672517-23672539 GAGTGGGGCCAGGAAGTGCAGGG - Intronic
927704291 2:25287447-25287469 GAGGGACCCCAGGAAGTGGTGGG - Intronic
931481243 2:62643037-62643059 CAGGGACACGAGGAAGTACAAGG - Intergenic
933255662 2:80078274-80078296 GAACTTCAACAGGAAGTGCAGGG + Intronic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
934581478 2:95444379-95444401 GAGGGGCTGCAGGGAGTGCAGGG - Intergenic
934597972 2:95632335-95632357 GAGGGGCTGCAGGGAGTGCAGGG + Intergenic
935155928 2:100483552-100483574 GCTGGTCACCAGGAAGACCAAGG + Intergenic
935423457 2:102894835-102894857 GAGGCTCACCAGGAGGGGAAGGG - Intergenic
935572258 2:104674088-104674110 GTGTGTCACCTGGAAGTGAAAGG - Intergenic
936113711 2:109685596-109685618 GAGGTCCACCAGGCCGTGCAGGG - Intergenic
937471997 2:122182065-122182087 GAGGGCCATCAGGACGTGCCTGG + Intergenic
946422916 2:219575057-219575079 GTGGGCCACCAGGAAGGGCGTGG - Exonic
946426753 2:219602595-219602617 GAGGGTTTCGAGGAAGGGCAAGG + Intronic
947143646 2:227043111-227043133 GAGGATCACCTGGAAGGCCAGGG - Exonic
947479182 2:230481842-230481864 TAGAGTCAACACGAAGTGCAAGG - Intronic
947751257 2:232533926-232533948 CAGGGTCTCCAGGAAGAGCTGGG - Exonic
947754856 2:232554639-232554661 GATGGTCTCCTGGAAGTCCAGGG + Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
1169816330 20:9660733-9660755 AAGAGTCAACAGCAAGTGCAAGG + Intronic
1170323553 20:15129988-15130010 GTGGGTGACCAGGAAGCACAGGG - Intronic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1174421019 20:50399253-50399275 AAGGGTTACCAGGCAGGGCATGG + Intergenic
1175691234 20:61067389-61067411 GAGGCTCACGAGGAAGTGAGAGG + Intergenic
1175931716 20:62496658-62496680 GAGGGTCTCCAGGAGGCGCCGGG + Intergenic
1176092950 20:63327000-63327022 GGGGGTCAACAGGAAGTTCCAGG - Intronic
1176092963 20:63327045-63327067 GGTGGTCAACAGGAAGTCCATGG - Intronic
1176622042 21:9067270-9067292 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1176862564 21:14019647-14019669 GGGGGTCACCTGAATGTGCATGG - Intergenic
1177839494 21:26220033-26220055 GAAGGTGACTAGGAAGTACATGG - Intergenic
1179418927 21:41220413-41220435 GCTGGTCACCAGAAAGAGCAAGG - Intronic
1179621460 21:42618917-42618939 GAGCGTCACCAGGTGGTGGAAGG + Intergenic
1179885481 21:44312504-44312526 GAGGGCACCCAGGCAGTGCATGG + Intronic
1180207880 21:46273463-46273485 CTGGGTCACCAGGTAGTCCATGG + Exonic
1181805945 22:25374539-25374561 GAGGGTGGCCAGGAAGGTCACGG - Intronic
1182161535 22:28127309-28127331 AAGGGTCACTAAGAAGTGTAAGG + Intronic
1182370919 22:29810171-29810193 GAGCATGATCAGGAAGTGCATGG - Intronic
1182951560 22:34381067-34381089 GAGCGTCACTTGGAACTGCAGGG - Intergenic
1182966315 22:34524922-34524944 GTAGCTCACCAGGAAGTGTAGGG - Intergenic
1184330293 22:43823002-43823024 GAGGGTCACCTGGACAGGCAGGG - Intergenic
1184388638 22:44190578-44190600 CAGGGCCACAAGGAGGTGCAGGG - Exonic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
951991115 3:28677138-28677160 GTGGGTCACCAGAAAGACCAGGG - Intergenic
953040743 3:39252965-39252987 GGCGGTCACCAGGCAGTGCTGGG + Intergenic
953896811 3:46809357-46809379 CAGGGTCACCAGGATGCCCAGGG + Intronic
954512591 3:51139462-51139484 GAGGGTCACCATGAAATGGACGG - Intronic
955854211 3:63255774-63255796 GAGTGTGAGCAGGAAGTGCAAGG + Intronic
956710349 3:72033498-72033520 GAAGGTGACCAGGAAATGAATGG + Intergenic
957615778 3:82524870-82524892 CTGAGACACCAGGAAGTGCAGGG - Intergenic
963042107 3:141077645-141077667 GAGCCTCACGAGGAAGAGCATGG + Intronic
965983083 3:174717218-174717240 GAGAGTCACCAGGAAGAGAGAGG - Intronic
967400314 3:189053537-189053559 GTTGGTCAACAGGAAGTGGAAGG - Intronic
967819062 3:193824488-193824510 GATGTCCACCAGGAAGTACATGG - Intergenic
968925596 4:3545653-3545675 GAGGGTCACCAGGACATCTAGGG - Intergenic
970406198 4:15766837-15766859 GAGTGTCACCAGGAAGCTCAGGG - Intergenic
972560141 4:40219745-40219767 GAAGTTCACCAGGAAGAGCCAGG + Intronic
972783109 4:42302698-42302720 GGGGGTCTCCAGGAACTGGATGG - Intergenic
977468162 4:97408107-97408129 GAGGGTCACCAGTAGCTCCAGGG + Intronic
978282932 4:107038077-107038099 GATGGTTACCAGGAATTGGAAGG + Intronic
981231112 4:142356801-142356823 GCTGGTCACCAGGAAGACCAAGG + Intronic
984013531 4:174400360-174400382 GAGGGTCACCAGAAAATGATGGG + Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
985660831 5:1155840-1155862 GGGGGTCACCACGAAGCGCTGGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986294066 5:6422971-6422993 GATGGTCAACAGGGAGTGCTGGG - Intergenic
987836605 5:23170578-23170600 GTTGGTCACCAGAAAGTCCAAGG - Intergenic
995131896 5:108639466-108639488 GTAGGTCACCAGGCACTGCAGGG - Intergenic
995169731 5:109093080-109093102 GATGGTTACCAGGGATTGCAAGG + Intronic
995498188 5:112772120-112772142 GGGGGTCACCTAGAAGAGCATGG - Intronic
997265035 5:132490471-132490493 GCGGGGCACCAGGAAGTGGGGGG - Intronic
998369844 5:141653969-141653991 GAGGGTGGACTGGAAGTGCATGG + Exonic
999894579 5:156016707-156016729 GAAGATCTCCATGAAGTGCATGG - Intronic
1001322914 5:170697685-170697707 GAGGGTCAGAAAGAAGTTCACGG - Intronic
1001773989 5:174315211-174315233 GGGAGTCCCAAGGAAGTGCAGGG + Intergenic
1002687503 5:181025021-181025043 GTGCCTCACCAGTAAGTGCAGGG - Intergenic
1004667319 6:17760700-17760722 GAGGTGGCCCAGGAAGTGCACGG + Intronic
1005481212 6:26257280-26257302 GAGGGTAAGGAGCAAGTGCAAGG + Intergenic
1006432743 6:34007830-34007852 GAGGGTCACCTGGAGGTGCCTGG + Intergenic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1008444262 6:51570196-51570218 GAGGGTTATTAGGAAGTGCCCGG - Intergenic
1018631627 6:165826964-165826986 GAGGGACATCAGGAGGGGCACGG + Intronic
1018792248 6:167157544-167157566 GAGGTCCAGCAGGAAGTGCAGGG + Exonic
1021614537 7:22488421-22488443 GAGGGTGACTAGGTAGGGCAAGG - Intronic
1022249432 7:28592725-28592747 AAGGGTCACCAAGAAGTGAGAGG + Intronic
1022342927 7:29485906-29485928 AAGGGTATCCTGGAAGTGCATGG - Intronic
1022944251 7:35266328-35266350 GTGGTTCACCAGCATGTGCAAGG + Intergenic
1022956846 7:35389082-35389104 GAGAGTCACCAGGAAGTGAGTGG + Intergenic
1025249806 7:57344207-57344229 AAGGGTTACCAGGCAGTGCATGG - Intergenic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1028683583 7:93567358-93567380 GAGGGTCTCCTGGATGTGCTGGG + Intronic
1028709880 7:93894625-93894647 CAAAGTCAACAGGAAGTGCAAGG + Intronic
1033437034 7:141342526-141342548 GAGGGTCATCAGGAAGACCTCGG - Intronic
1033554253 7:142474622-142474644 AAGGGTCTCTAGGAGGTGCAAGG - Intergenic
1033556520 7:142492727-142492749 AAGGGTCTCTAGGAGGTGCAAGG - Intergenic
1034077424 7:148245633-148245655 CAGGGTCACCATGAGGTTCAAGG + Intronic
1034592052 7:152149274-152149296 GAGAGTCAGCAGTAAGTGCTGGG + Intronic
1037512499 8:19598046-19598068 GAGGGTCAAGAGGAAGGGGAAGG + Intronic
1037912083 8:22749490-22749512 GGGTGTCACCAGCAAGGGCACGG + Intronic
1039637748 8:39184298-39184320 GAGGGCCAAGAGGAAGTGCCTGG - Intronic
1039886174 8:41655183-41655205 GAGCGTCACCAGGGAGTCGAGGG + Intronic
1046511684 8:115212004-115212026 AAGGGTCCCAAGGTAGTGCAGGG - Intergenic
1047035007 8:120927968-120927990 AAGGATCAGCAGGAAGAGCATGG + Intergenic
1048413731 8:134203142-134203164 GAAGTTCACCAGGAAGGGAAAGG + Intergenic
1048517971 8:135127624-135127646 GAGCTTCACCAGCATGTGCATGG - Intergenic
1048521296 8:135157812-135157834 TAGGGTCACCAGGAAGGACTTGG - Intergenic
1049599132 8:143498924-143498946 GAGGGGCACAGGGCAGTGCAGGG + Intronic
1049747784 8:144270279-144270301 CAGGGTCAAGAGGGAGTGCAGGG + Intronic
1050066188 9:1761851-1761873 GGTGGTTACCAGGAACTGCAGGG - Intergenic
1051374226 9:16387856-16387878 GAGGCTCACCAAGGGGTGCAGGG + Intergenic
1052185566 9:25589744-25589766 GAGGGTTACAAGGACATGCAGGG + Intergenic
1053330581 9:37203056-37203078 GGGGGCAACTAGGAAGTGCAGGG + Intronic
1053519981 9:38767563-38767585 GAGGTTCACGTGGGAGTGCATGG - Intergenic
1053653396 9:40191777-40191799 GAGGGTCACGAGGAAGATCCAGG + Intergenic
1053800478 9:41760834-41760856 GAGGGTCACCAGGACATCTAGGG - Intergenic
1054144713 9:61554001-61554023 GAGGGTCACCAGGACATCTAGGG + Intergenic
1054188908 9:61972986-61973008 GAGGGTCACCAGGACATCTAGGG - Intergenic
1054464403 9:65484958-65484980 GAGGGTCACCAGGACATCTAGGG + Intergenic
1054531188 9:66184441-66184463 GAGGGTCACGAGGAAGATCCAGG - Intergenic
1054649610 9:67615631-67615653 GAGGGTCACCAGGACATCTAGGG + Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1060343872 9:122800298-122800320 GTGGGCCAGCAGGAAGTACATGG - Exonic
1061249069 9:129416085-129416107 GGGGGTGAGCAGGAAGGGCAGGG - Intergenic
1061389324 9:130308627-130308649 TAGGGTCACCAGCAAGTGGGTGG + Intronic
1061420536 9:130470971-130470993 GGGGGTCACCAGGACGTCCTGGG - Intronic
1061771937 9:132931729-132931751 GAGGGTCTACAGTAAGTGCAAGG + Intronic
1186606463 X:11097963-11097985 AAGGGTTACCAGGATGAGCAAGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1188906911 X:35800926-35800948 TTGGGTGTCCAGGAAGTGCAAGG + Intronic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1188985443 X:36764699-36764721 TAAGTTCACCAGGAAGTGCATGG - Intergenic
1189421274 X:40860419-40860441 CAGGGTCCCAAGGCAGTGCAAGG + Intergenic
1191640745 X:63428180-63428202 GATGGTCTACAGGGAGTGCAAGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1195218416 X:102722591-102722613 GATGGTCACCAGAAAGACCAAGG - Intronic
1195275116 X:103274337-103274359 GAGGGAAACCAGGAAAAGCAGGG - Exonic
1201158563 Y:11152727-11152749 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic