ID: 1122363449

View in Genome Browser
Species Human (GRCh38)
Location 14:101180929-101180951
Sequence CCTGTCATGGGAGGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122363449_1122363460 25 Left 1122363449 14:101180929-101180951 CCTGACACACCTCCCATGACAGG No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363449_1122363459 24 Left 1122363449 14:101180929-101180951 CCTGACACACCTCCCATGACAGG No data
Right 1122363459 14:101180976-101180998 CCGATTCACCTTGTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122363449 Original CRISPR CCTGTCATGGGAGGTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr