ID: 1122363460

View in Genome Browser
Species Human (GRCh38)
Location 14:101180977-101180999
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122363453_1122363460 13 Left 1122363453 14:101180941-101180963 CCCATGACAGGGAGCTCATTACC No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363452_1122363460 16 Left 1122363452 14:101180938-101180960 CCTCCCATGACAGGGAGCTCATT No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363456_1122363460 -9 Left 1122363456 14:101180963-101180985 CCTTCAAGATATCCCGATTCACC No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363455_1122363460 -8 Left 1122363455 14:101180962-101180984 CCCTTCAAGATATCCCGATTCAC No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363449_1122363460 25 Left 1122363449 14:101180929-101180951 CCTGACACACCTCCCATGACAGG No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data
1122363454_1122363460 12 Left 1122363454 14:101180942-101180964 CCATGACAGGGAGCTCATTACCC No data
Right 1122363460 14:101180977-101180999 CGATTCACCTTGTCCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122363460 Original CRISPR CGATTCACCTTGTCCTCAAA GGG Intergenic
No off target data available for this crispr