ID: 1122363965

View in Genome Browser
Species Human (GRCh38)
Location 14:101183435-101183457
Sequence TGGTGCCCCCTAGCGGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122363965_1122363974 16 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363974 14:101183474-101183496 ACGAGGGGCTGCTTTTCCCCAGG No data
1122363965_1122363973 1 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363973 14:101183459-101183481 GAGCTGCGGCTGCGGACGAGGGG No data
1122363965_1122363976 25 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363976 14:101183483-101183505 TGCTTTTCCCCAGGCGCTGTGGG No data
1122363965_1122363971 -1 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363971 14:101183457-101183479 ATGAGCTGCGGCTGCGGACGAGG No data
1122363965_1122363969 -7 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363969 14:101183451-101183473 GGCACCATGAGCTGCGGCTGCGG No data
1122363965_1122363975 24 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363975 14:101183482-101183504 CTGCTTTTCCCCAGGCGCTGTGG No data
1122363965_1122363972 0 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363972 14:101183458-101183480 TGAGCTGCGGCTGCGGACGAGGG No data
1122363965_1122363977 30 Left 1122363965 14:101183435-101183457 CCGGATCCCGCTAGGGGGCACCA No data
Right 1122363977 14:101183488-101183510 TTCCCCAGGCGCTGTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122363965 Original CRISPR TGGTGCCCCCTAGCGGGATC CGG (reversed) Intergenic
No off target data available for this crispr