ID: 1122364000

View in Genome Browser
Species Human (GRCh38)
Location 14:101183578-101183600
Sequence CAGCCTTCACACTAGGACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122363991_1122364000 11 Left 1122363991 14:101183544-101183566 CCAGTCCTGGAGCCAGGCCACCT No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data
1122363998_1122364000 -9 Left 1122363998 14:101183564-101183586 CCTGGTGGGCAGTGCAGCCTTCA No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data
1122363997_1122364000 -6 Left 1122363997 14:101183561-101183583 CCACCTGGTGGGCAGTGCAGCCT No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data
1122363989_1122364000 20 Left 1122363989 14:101183535-101183557 CCTCTCTTTCCAGTCCTGGAGCC No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data
1122363996_1122364000 -1 Left 1122363996 14:101183556-101183578 CCAGGCCACCTGGTGGGCAGTGC No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data
1122363993_1122364000 6 Left 1122363993 14:101183549-101183571 CCTGGAGCCAGGCCACCTGGTGG No data
Right 1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122364000 Original CRISPR CAGCCTTCACACTAGGACCG CGG Intergenic
No off target data available for this crispr