ID: 1122364312

View in Genome Browser
Species Human (GRCh38)
Location 14:101185459-101185481
Sequence GATTTGCCCAGCTTCCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122364307_1122364312 13 Left 1122364307 14:101185423-101185445 CCAGCAGAGTCTGCAAGAGGAGG No data
Right 1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG No data
1122364306_1122364312 14 Left 1122364306 14:101185422-101185444 CCCAGCAGAGTCTGCAAGAGGAG No data
Right 1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122364312 Original CRISPR GATTTGCCCAGCTTCCTCCC GGG Intergenic
No off target data available for this crispr