ID: 1122366730

View in Genome Browser
Species Human (GRCh38)
Location 14:101198787-101198809
Sequence TCTCCCATGACTGGGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366730_1122366741 30 Left 1122366730 14:101198787-101198809 CCACAGCTCCCAGTCATGGGAGA No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366730 Original CRISPR TCTCCCATGACTGGGAGCTG TGG (reversed) Intergenic
No off target data available for this crispr