ID: 1122366731

View in Genome Browser
Species Human (GRCh38)
Location 14:101198795-101198817
Sequence CTGAGGTCTCTCCCATGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366731_1122366741 22 Left 1122366731 14:101198795-101198817 CCCAGTCATGGGAGAGACCTCAG No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366731 Original CRISPR CTGAGGTCTCTCCCATGACT GGG (reversed) Intergenic
No off target data available for this crispr