ID: 1122366735

View in Genome Browser
Species Human (GRCh38)
Location 14:101198812-101198834
Sequence AGACACAGCGTAGGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366735_1122366745 18 Left 1122366735 14:101198812-101198834 CCTCAGGGCCCTACGCTGTGTCT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366735_1122366741 5 Left 1122366735 14:101198812-101198834 CCTCAGGGCCCTACGCTGTGTCT No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366735 Original CRISPR AGACACAGCGTAGGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr