ID: 1122366736

View in Genome Browser
Species Human (GRCh38)
Location 14:101198820-101198842
Sequence AGGAAGGGAGACACAGCGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366736_1122366741 -3 Left 1122366736 14:101198820-101198842 CCCTACGCTGTGTCTCCCTTCCT No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366736_1122366745 10 Left 1122366736 14:101198820-101198842 CCCTACGCTGTGTCTCCCTTCCT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366736 Original CRISPR AGGAAGGGAGACACAGCGTA GGG (reversed) Intergenic
No off target data available for this crispr