ID: 1122366740

View in Genome Browser
Species Human (GRCh38)
Location 14:101198840-101198862
Sequence CCATGAGCAGTGGGCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366740_1122366745 -10 Left 1122366740 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366740 Original CRISPR CCATGAGCAGTGGGCTTGGA AGG (reversed) Intergenic
No off target data available for this crispr