ID: 1122366741

View in Genome Browser
Species Human (GRCh38)
Location 14:101198840-101198862
Sequence CCTTCCAAGCCCACTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366735_1122366741 5 Left 1122366735 14:101198812-101198834 CCTCAGGGCCCTACGCTGTGTCT No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366737_1122366741 -4 Left 1122366737 14:101198821-101198843 CCTACGCTGTGTCTCCCTTCCTT No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366730_1122366741 30 Left 1122366730 14:101198787-101198809 CCACAGCTCCCAGTCATGGGAGA No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366731_1122366741 22 Left 1122366731 14:101198795-101198817 CCCAGTCATGGGAGAGACCTCAG No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366736_1122366741 -3 Left 1122366736 14:101198820-101198842 CCCTACGCTGTGTCTCCCTTCCT No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
1122366732_1122366741 21 Left 1122366732 14:101198796-101198818 CCAGTCATGGGAGAGACCTCAGG No data
Right 1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366741 Original CRISPR CCTTCCAAGCCCACTGCTCA TGG Intergenic
No off target data available for this crispr