ID: 1122366745

View in Genome Browser
Species Human (GRCh38)
Location 14:101198853-101198875
Sequence CTGCTCATGGCATTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122366738_1122366745 -5 Left 1122366738 14:101198835-101198857 CCCTTCCTTCCAAGCCCACTGCT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366735_1122366745 18 Left 1122366735 14:101198812-101198834 CCTCAGGGCCCTACGCTGTGTCT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366737_1122366745 9 Left 1122366737 14:101198821-101198843 CCTACGCTGTGTCTCCCTTCCTT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366740_1122366745 -10 Left 1122366740 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366739_1122366745 -6 Left 1122366739 14:101198836-101198858 CCTTCCTTCCAAGCCCACTGCTC No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data
1122366736_1122366745 10 Left 1122366736 14:101198820-101198842 CCCTACGCTGTGTCTCCCTTCCT No data
Right 1122366745 14:101198853-101198875 CTGCTCATGGCATTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122366745 Original CRISPR CTGCTCATGGCATTTCCCTC AGG Intergenic
No off target data available for this crispr