ID: 1122368305

View in Genome Browser
Species Human (GRCh38)
Location 14:101211904-101211926
Sequence CCAGTAGTTCACATCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122368297_1122368305 18 Left 1122368297 14:101211863-101211885 CCCACAGTGCCGGGATTACAGGC 0: 19
1: 3912
2: 230656
3: 275971
4: 183429
Right 1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG No data
1122368299_1122368305 9 Left 1122368299 14:101211872-101211894 CCGGGATTACAGGCGTGAGCCAC 0: 1439
1: 4118
2: 4437
3: 3954
4: 4071
Right 1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG No data
1122368298_1122368305 17 Left 1122368298 14:101211864-101211886 CCACAGTGCCGGGATTACAGGCG 0: 10
1: 2044
2: 131968
3: 279330
4: 223813
Right 1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG No data
1122368301_1122368305 -10 Left 1122368301 14:101211891-101211913 CCACCACTCCTGGCCAGTAGTTC No data
Right 1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122368305 Original CRISPR CCAGTAGTTCACATCTTTAT AGG Intergenic
No off target data available for this crispr