ID: 1122368928

View in Genome Browser
Species Human (GRCh38)
Location 14:101216887-101216909
Sequence GGGGGTGTTGCAAGAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122368928_1122368939 22 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368939 14:101216932-101216954 AGAGGGTCGTGGGAATCTCAAGG No data
1122368928_1122368936 11 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368936 14:101216921-101216943 GCAGTCAAGCCAGAGGGTCGTGG No data
1122368928_1122368940 23 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368940 14:101216933-101216955 GAGGGTCGTGGGAATCTCAAGGG No data
1122368928_1122368937 12 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368937 14:101216922-101216944 CAGTCAAGCCAGAGGGTCGTGGG No data
1122368928_1122368933 4 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368933 14:101216914-101216936 CACCACTGCAGTCAAGCCAGAGG No data
1122368928_1122368934 5 Left 1122368928 14:101216887-101216909 CCATGAACTCTTGCAACACCCCC No data
Right 1122368934 14:101216915-101216937 ACCACTGCAGTCAAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122368928 Original CRISPR GGGGGTGTTGCAAGAGTTCA TGG (reversed) Intergenic
No off target data available for this crispr