ID: 1122371422

View in Genome Browser
Species Human (GRCh38)
Location 14:101230771-101230793
Sequence CTAGGTGACCACTAGGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122371415_1122371422 4 Left 1122371415 14:101230744-101230766 CCAGAACCACAGCCTGAGCATTG No data
Right 1122371422 14:101230771-101230793 CTAGGTGACCACTAGGTCCAAGG No data
1122371418_1122371422 -8 Left 1122371418 14:101230756-101230778 CCTGAGCATTGCACCCTAGGTGA No data
Right 1122371422 14:101230771-101230793 CTAGGTGACCACTAGGTCCAAGG No data
1122371416_1122371422 -2 Left 1122371416 14:101230750-101230772 CCACAGCCTGAGCATTGCACCCT No data
Right 1122371422 14:101230771-101230793 CTAGGTGACCACTAGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122371422 Original CRISPR CTAGGTGACCACTAGGTCCA AGG Intergenic
No off target data available for this crispr