ID: 1122376251

View in Genome Browser
Species Human (GRCh38)
Location 14:101261074-101261096
Sequence CTGTGGATAAAGGGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122376235_1122376251 23 Left 1122376235 14:101261028-101261050 CCATCCATGGTTTCAGGCACCCA No data
Right 1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG No data
1122376236_1122376251 19 Left 1122376236 14:101261032-101261054 CCATGGTTTCAGGCACCCACTGG No data
Right 1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG No data
1122376242_1122376251 4 Left 1122376242 14:101261047-101261069 CCCACTGGGGGTCTTGGAACGTA 0: 3
1: 20
2: 42
3: 74
4: 141
Right 1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG No data
1122376243_1122376251 3 Left 1122376243 14:101261048-101261070 CCACTGGGGGTCTTGGAACGTAT 0: 14
1: 266
2: 528
3: 702
4: 774
Right 1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122376251 Original CRISPR CTGTGGATAAAGGGGGATGA TGG Intergenic
No off target data available for this crispr