ID: 1122376793

View in Genome Browser
Species Human (GRCh38)
Location 14:101266557-101266579
Sequence CAGCGAGACACCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122376793_1122376796 13 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376796 14:101266593-101266615 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1122376793_1122376798 24 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376798 14:101266604-101266626 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
1122376793_1122376800 29 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376800 14:101266609-101266631 TGCAAGGCGGCAGCGAGGCCGGG 0: 8
1: 1102
2: 2184
3: 1759
4: 976
1122376793_1122376797 16 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376797 14:101266596-101266618 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1122376793_1122376801 30 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376801 14:101266610-101266632 GCAAGGCGGCAGCGAGGCCGGGG 0: 7
1: 1077
2: 2150
3: 1750
4: 965
1122376793_1122376799 28 Left 1122376793 14:101266557-101266579 CCTACGCCCACGGTGTCTCGCTG No data
Right 1122376799 14:101266608-101266630 CTGCAAGGCGGCAGCGAGGCCGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122376793 Original CRISPR CAGCGAGACACCGTGGGCGT AGG (reversed) Intergenic
No off target data available for this crispr