ID: 1122379622

View in Genome Browser
Species Human (GRCh38)
Location 14:101293163-101293185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122379617_1122379622 12 Left 1122379617 14:101293128-101293150 CCAGACATGGGAAAACAAGCAGC No data
Right 1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122379622 Original CRISPR CTCCAAGAGAAGAGGGGACA GGG Intergenic
No off target data available for this crispr