ID: 1122380262

View in Genome Browser
Species Human (GRCh38)
Location 14:101298696-101298718
Sequence CAAAAATCAAGCTGAAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122380260_1122380262 12 Left 1122380260 14:101298661-101298683 CCTCATAGAACTTTACATTCATT No data
Right 1122380262 14:101298696-101298718 CAAAAATCAAGCTGAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122380262 Original CRISPR CAAAAATCAAGCTGAAGCTC AGG Intergenic
No off target data available for this crispr