ID: 1122381562

View in Genome Browser
Species Human (GRCh38)
Location 14:101310556-101310578
Sequence GCATCTCCTTTGTCTCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122381558_1122381562 22 Left 1122381558 14:101310511-101310533 CCGAGTCTGTGACCGGTGCTGGA No data
Right 1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG No data
1122381559_1122381562 10 Left 1122381559 14:101310523-101310545 CCGGTGCTGGAGTTTTGCGTCCA No data
Right 1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG No data
1122381556_1122381562 23 Left 1122381556 14:101310510-101310532 CCCGAGTCTGTGACCGGTGCTGG No data
Right 1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG No data
1122381561_1122381562 -10 Left 1122381561 14:101310543-101310565 CCACGGATAAAATGCATCTCCTT No data
Right 1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122381562 Original CRISPR GCATCTCCTTTGTCTCTACC AGG Intergenic
No off target data available for this crispr