ID: 1122383352

View in Genome Browser
Species Human (GRCh38)
Location 14:101326466-101326488
Sequence AAGGGTAATCAGAGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122383352_1122383354 -7 Left 1122383352 14:101326466-101326488 CCTGTAGTCCTCTGATTACCCTT No data
Right 1122383354 14:101326482-101326504 TACCCTTCCATTTTTTTCTATGG No data
1122383352_1122383355 -6 Left 1122383352 14:101326466-101326488 CCTGTAGTCCTCTGATTACCCTT No data
Right 1122383355 14:101326483-101326505 ACCCTTCCATTTTTTTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122383352 Original CRISPR AAGGGTAATCAGAGGACTAC AGG (reversed) Intergenic
No off target data available for this crispr