ID: 1122384278

View in Genome Browser
Species Human (GRCh38)
Location 14:101333430-101333452
Sequence CTGGTGACCCAGAAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122384270_1122384278 26 Left 1122384270 14:101333381-101333403 CCTACACGGCCACAAGTGCCACG No data
Right 1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG No data
1122384271_1122384278 17 Left 1122384271 14:101333390-101333412 CCACAAGTGCCACGTCTGCAACC No data
Right 1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG No data
1122384272_1122384278 8 Left 1122384272 14:101333399-101333421 CCACGTCTGCAACCAGTCACACT No data
Right 1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG No data
1122384273_1122384278 -4 Left 1122384273 14:101333411-101333433 CCAGTCACACTTAAGCCCTCTGG No data
Right 1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122384278 Original CRISPR CTGGTGACCCAGAAGAAAAA GGG Intergenic
No off target data available for this crispr