ID: 1122384804

View in Genome Browser
Species Human (GRCh38)
Location 14:101337069-101337091
Sequence GTCGAGCAATTTTGTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122384804_1122384807 11 Left 1122384804 14:101337069-101337091 CCTTGAAGACAAAATTGCTCGAC No data
Right 1122384807 14:101337103-101337125 TAACATTTGAGGAGTTGCTGTGG No data
1122384804_1122384808 15 Left 1122384804 14:101337069-101337091 CCTTGAAGACAAAATTGCTCGAC No data
Right 1122384808 14:101337107-101337129 ATTTGAGGAGTTGCTGTGGCCGG No data
1122384804_1122384805 0 Left 1122384804 14:101337069-101337091 CCTTGAAGACAAAATTGCTCGAC No data
Right 1122384805 14:101337092-101337114 TCAGCCAGTAGTAACATTTGAGG No data
1122384804_1122384809 22 Left 1122384804 14:101337069-101337091 CCTTGAAGACAAAATTGCTCGAC No data
Right 1122384809 14:101337114-101337136 GAGTTGCTGTGGCCGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122384804 Original CRISPR GTCGAGCAATTTTGTCTTCA AGG (reversed) Intergenic