ID: 1122384808

View in Genome Browser
Species Human (GRCh38)
Location 14:101337107-101337129
Sequence ATTTGAGGAGTTGCTGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122384804_1122384808 15 Left 1122384804 14:101337069-101337091 CCTTGAAGACAAAATTGCTCGAC No data
Right 1122384808 14:101337107-101337129 ATTTGAGGAGTTGCTGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122384808 Original CRISPR ATTTGAGGAGTTGCTGTGGC CGG Intergenic