ID: 1122386198

View in Genome Browser
Species Human (GRCh38)
Location 14:101349973-101349995
Sequence GACCCACAAATATGCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122386198_1122386204 21 Left 1122386198 14:101349973-101349995 CCAGCTTGGCATATTTGTGGGTC No data
Right 1122386204 14:101350017-101350039 TACTCTACAGGCAGCTAAAAAGG No data
1122386198_1122386201 9 Left 1122386198 14:101349973-101349995 CCAGCTTGGCATATTTGTGGGTC No data
Right 1122386201 14:101350005-101350027 CCAGCCTTTGCCTACTCTACAGG No data
1122386198_1122386205 27 Left 1122386198 14:101349973-101349995 CCAGCTTGGCATATTTGTGGGTC No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data
1122386198_1122386206 28 Left 1122386198 14:101349973-101349995 CCAGCTTGGCATATTTGTGGGTC No data
Right 1122386206 14:101350024-101350046 CAGGCAGCTAAAAAGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122386198 Original CRISPR GACCCACAAATATGCCAAGC TGG (reversed) Intergenic