ID: 1122386200

View in Genome Browser
Species Human (GRCh38)
Location 14:101350005-101350027
Sequence CCTGTAGAGTAGGCAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122386200_1122386206 -4 Left 1122386200 14:101350005-101350027 CCAGCCTTTGCCTACTCTACAGG No data
Right 1122386206 14:101350024-101350046 CAGGCAGCTAAAAAGGACTTGGG No data
1122386200_1122386205 -5 Left 1122386200 14:101350005-101350027 CCAGCCTTTGCCTACTCTACAGG No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122386200 Original CRISPR CCTGTAGAGTAGGCAAAGGC TGG (reversed) Intergenic
No off target data available for this crispr