ID: 1122386200 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:101350005-101350027 |
Sequence | CCTGTAGAGTAGGCAAAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122386200_1122386206 | -4 | Left | 1122386200 | 14:101350005-101350027 | CCAGCCTTTGCCTACTCTACAGG | No data | ||
Right | 1122386206 | 14:101350024-101350046 | CAGGCAGCTAAAAAGGACTTGGG | No data | ||||
1122386200_1122386205 | -5 | Left | 1122386200 | 14:101350005-101350027 | CCAGCCTTTGCCTACTCTACAGG | No data | ||
Right | 1122386205 | 14:101350023-101350045 | ACAGGCAGCTAAAAAGGACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122386200 | Original CRISPR | CCTGTAGAGTAGGCAAAGGC TGG (reversed) | Intergenic | ||