ID: 1122386202

View in Genome Browser
Species Human (GRCh38)
Location 14:101350009-101350031
Sequence GCTGCCTGTAGAGTAGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122386202_1122386205 -9 Left 1122386202 14:101350009-101350031 CCTTTGCCTACTCTACAGGCAGC No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data
1122386202_1122386206 -8 Left 1122386202 14:101350009-101350031 CCTTTGCCTACTCTACAGGCAGC No data
Right 1122386206 14:101350024-101350046 CAGGCAGCTAAAAAGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122386202 Original CRISPR GCTGCCTGTAGAGTAGGCAA AGG (reversed) Intergenic