ID: 1122386205

View in Genome Browser
Species Human (GRCh38)
Location 14:101350023-101350045
Sequence ACAGGCAGCTAAAAAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122386200_1122386205 -5 Left 1122386200 14:101350005-101350027 CCAGCCTTTGCCTACTCTACAGG No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data
1122386202_1122386205 -9 Left 1122386202 14:101350009-101350031 CCTTTGCCTACTCTACAGGCAGC No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data
1122386198_1122386205 27 Left 1122386198 14:101349973-101349995 CCAGCTTGGCATATTTGTGGGTC No data
Right 1122386205 14:101350023-101350045 ACAGGCAGCTAAAAAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122386205 Original CRISPR ACAGGCAGCTAAAAAGGACT TGG Intergenic