ID: 1122389202

View in Genome Browser
Species Human (GRCh38)
Location 14:101368775-101368797
Sequence CTGTCCTAAGGGCTGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122389189_1122389202 30 Left 1122389189 14:101368722-101368744 CCTTAATTATACGTAAGAAAAAT No data
Right 1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG No data
1122389193_1122389202 -7 Left 1122389193 14:101368759-101368781 CCGCCCTTGCTTACCTCTGTCCT No data
Right 1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG No data
1122389194_1122389202 -10 Left 1122389194 14:101368762-101368784 CCCTTGCTTACCTCTGTCCTAAG No data
Right 1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122389202 Original CRISPR CTGTCCTAAGGGCTGGTGTG GGG Intergenic
No off target data available for this crispr