ID: 1122389947

View in Genome Browser
Species Human (GRCh38)
Location 14:101373381-101373403
Sequence CAGCAGAAAGGGAAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122389947_1122389952 -4 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389947_1122389956 8 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389956 14:101373412-101373434 CTGAGTCCTGGCTGAGCCTCTGG No data
1122389947_1122389958 15 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389947_1122389959 21 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389959 14:101373425-101373447 GAGCCTCTGGAACATGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122389947 Original CRISPR CAGCAGAAAGGGAAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr