ID: 1122389952

View in Genome Browser
Species Human (GRCh38)
Location 14:101373400-101373422
Sequence GCTGCCCGTTTCCTGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122389936_1122389952 27 Left 1122389936 14:101373350-101373372 CCTCCGACCCTCCCTCTACTGCC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389942_1122389952 16 Left 1122389942 14:101373361-101373383 CCCTCTACTGCCCAGGCCGGCCC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389943_1122389952 15 Left 1122389943 14:101373362-101373384 CCTCTACTGCCCAGGCCGGCCCT No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389947_1122389952 -4 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389946_1122389952 0 Left 1122389946 14:101373377-101373399 CCGGCCCTCCAACTTCCCTTTCT No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389944_1122389952 6 Left 1122389944 14:101373371-101373393 CCCAGGCCGGCCCTCCAACTTCC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389935_1122389952 28 Left 1122389935 14:101373349-101373371 CCCTCCGACCCTCCCTCTACTGC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389937_1122389952 24 Left 1122389937 14:101373353-101373375 CCGACCCTCCCTCTACTGCCCAG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389948_1122389952 -5 Left 1122389948 14:101373382-101373404 CCTCCAACTTCCCTTTCTGCTGC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389949_1122389952 -8 Left 1122389949 14:101373385-101373407 CCAACTTCCCTTTCTGCTGCCCG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389939_1122389952 20 Left 1122389939 14:101373357-101373379 CCCTCCCTCTACTGCCCAGGCCG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389940_1122389952 19 Left 1122389940 14:101373358-101373380 CCTCCCTCTACTGCCCAGGCCGG No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data
1122389945_1122389952 5 Left 1122389945 14:101373372-101373394 CCAGGCCGGCCCTCCAACTTCCC No data
Right 1122389952 14:101373400-101373422 GCTGCCCGTTTCCTGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122389952 Original CRISPR GCTGCCCGTTTCCTGAGTCC TGG Intergenic
No off target data available for this crispr