ID: 1122389958

View in Genome Browser
Species Human (GRCh38)
Location 14:101373419-101373441
Sequence CTGGCTGAGCCTCTGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122389945_1122389958 24 Left 1122389945 14:101373372-101373394 CCAGGCCGGCCCTCCAACTTCCC No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389946_1122389958 19 Left 1122389946 14:101373377-101373399 CCGGCCCTCCAACTTCCCTTTCT No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389949_1122389958 11 Left 1122389949 14:101373385-101373407 CCAACTTCCCTTTCTGCTGCCCG No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389953_1122389958 -8 Left 1122389953 14:101373404-101373426 CCCGTTTCCTGAGTCCTGGCTGA No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389947_1122389958 15 Left 1122389947 14:101373381-101373403 CCCTCCAACTTCCCTTTCTGCTG No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389944_1122389958 25 Left 1122389944 14:101373371-101373393 CCCAGGCCGGCCCTCCAACTTCC No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389948_1122389958 14 Left 1122389948 14:101373382-101373404 CCTCCAACTTCCCTTTCTGCTGC No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389951_1122389958 3 Left 1122389951 14:101373393-101373415 CCTTTCTGCTGCCCGTTTCCTGA No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389954_1122389958 -9 Left 1122389954 14:101373405-101373427 CCGTTTCCTGAGTCCTGGCTGAG No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data
1122389950_1122389958 4 Left 1122389950 14:101373392-101373414 CCCTTTCTGCTGCCCGTTTCCTG No data
Right 1122389958 14:101373419-101373441 CTGGCTGAGCCTCTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122389958 Original CRISPR CTGGCTGAGCCTCTGGAACA TGG Intergenic
No off target data available for this crispr