ID: 1122393065

View in Genome Browser
Species Human (GRCh38)
Location 14:101403561-101403583
Sequence TCCGGCCACATGGAGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122393065_1122393073 -3 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393073 14:101403581-101403603 GGAGCAGGGCTGCGGTGGGAAGG No data
1122393065_1122393079 15 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393079 14:101403599-101403621 GAAGGGGAAGGATGGAGACTGGG No data
1122393065_1122393070 -8 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393070 14:101403576-101403598 TGGCCGGAGCAGGGCTGCGGTGG No data
1122393065_1122393080 16 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393080 14:101403600-101403622 AAGGGGAAGGATGGAGACTGGGG No data
1122393065_1122393078 14 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393078 14:101403598-101403620 GGAAGGGGAAGGATGGAGACTGG No data
1122393065_1122393076 3 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393076 14:101403587-101403609 GGGCTGCGGTGGGAAGGGGAAGG No data
1122393065_1122393071 -7 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393071 14:101403577-101403599 GGCCGGAGCAGGGCTGCGGTGGG No data
1122393065_1122393077 7 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393077 14:101403591-101403613 TGCGGTGGGAAGGGGAAGGATGG No data
1122393065_1122393074 -2 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393074 14:101403582-101403604 GAGCAGGGCTGCGGTGGGAAGGG No data
1122393065_1122393075 -1 Left 1122393065 14:101403561-101403583 CCACAGAGCTCCATGTGGCCGGA No data
Right 1122393075 14:101403583-101403605 AGCAGGGCTGCGGTGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122393065 Original CRISPR TCCGGCCACATGGAGCTCTG TGG (reversed) Intergenic
No off target data available for this crispr