ID: 1122393760

View in Genome Browser
Species Human (GRCh38)
Location 14:101408182-101408204
Sequence CAGGCAGATGAGGCTGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122393760_1122393771 26 Left 1122393760 14:101408182-101408204 CCTGCGCCAGCCTCATCTGCCTG No data
Right 1122393771 14:101408231-101408253 ACCTCCGTCCTCTCTCTGCTGGG No data
1122393760_1122393770 25 Left 1122393760 14:101408182-101408204 CCTGCGCCAGCCTCATCTGCCTG No data
Right 1122393770 14:101408230-101408252 CACCTCCGTCCTCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122393760 Original CRISPR CAGGCAGATGAGGCTGGCGC AGG (reversed) Intergenic
No off target data available for this crispr