ID: 1122395631

View in Genome Browser
Species Human (GRCh38)
Location 14:101427533-101427555
Sequence GTAAACCCCTTGACTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122395631_1122395637 25 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395637 14:101427581-101427603 GAAAGCCAAGATCTTCAGGATGG No data
1122395631_1122395640 30 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395640 14:101427586-101427608 CCAAGATCTTCAGGATGGGTTGG No data
1122395631_1122395636 21 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395636 14:101427577-101427599 GAAAGAAAGCCAAGATCTTCAGG No data
1122395631_1122395638 26 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395638 14:101427582-101427604 AAAGCCAAGATCTTCAGGATGGG No data
1122395631_1122395635 -1 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395635 14:101427555-101427577 CAGAGATGGCAGGAATTCGTGGG No data
1122395631_1122395634 -2 Left 1122395631 14:101427533-101427555 CCTAGAAAAGTCAAGGGGTTTAC No data
Right 1122395634 14:101427554-101427576 ACAGAGATGGCAGGAATTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122395631 Original CRISPR GTAAACCCCTTGACTTTTCT AGG (reversed) Intergenic
No off target data available for this crispr