ID: 1122395672

View in Genome Browser
Species Human (GRCh38)
Location 14:101427785-101427807
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122395666_1122395672 12 Left 1122395666 14:101427750-101427772 CCACAGCATGGAGTTTTGGGGGG No data
Right 1122395672 14:101427785-101427807 GGGACCTGGCCAATATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122395672 Original CRISPR GGGACCTGGCCAATATGATG AGG Intergenic
No off target data available for this crispr