ID: 1122398046

View in Genome Browser
Species Human (GRCh38)
Location 14:101449204-101449226
Sequence GTTATTCCCCCCTCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122398046_1122398049 6 Left 1122398046 14:101449204-101449226 CCACACCCAGAGGGGGGAATAAC No data
Right 1122398049 14:101449233-101449255 AGAAAACAACGCTCAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122398046 Original CRISPR GTTATTCCCCCCTCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr