ID: 1122398049

View in Genome Browser
Species Human (GRCh38)
Location 14:101449233-101449255
Sequence AGAAAACAACGCTCAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122398047_1122398049 1 Left 1122398047 14:101449209-101449231 CCCAGAGGGGGGAATAACACTTG No data
Right 1122398049 14:101449233-101449255 AGAAAACAACGCTCAGAAATTGG No data
1122398046_1122398049 6 Left 1122398046 14:101449204-101449226 CCACACCCAGAGGGGGGAATAAC No data
Right 1122398049 14:101449233-101449255 AGAAAACAACGCTCAGAAATTGG No data
1122398048_1122398049 0 Left 1122398048 14:101449210-101449232 CCAGAGGGGGGAATAACACTTGC No data
Right 1122398049 14:101449233-101449255 AGAAAACAACGCTCAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122398049 Original CRISPR AGAAAACAACGCTCAGAAAT TGG Intergenic
No off target data available for this crispr