ID: 1122399145

View in Genome Browser
Species Human (GRCh38)
Location 14:101457400-101457422
Sequence TGGGACCCCCCGCCCCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122399145_1122399153 -2 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399153 14:101457421-101457443 CAGGCGGCCACCGGGCGTCGCGG No data
1122399145_1122399150 -10 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399150 14:101457413-101457435 GGGGGTCCCAGGCGGCCACCGGG No data
1122399145_1122399161 30 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399161 14:101457453-101457475 GCATCAGCATTCCGGCGGCGCGG No data
1122399145_1122399160 25 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399160 14:101457448-101457470 CTGCGGCATCAGCATTCCGGCGG No data
1122399145_1122399156 8 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399156 14:101457431-101457453 CCGGGCGTCGCGGCCGCCTGCGG No data
1122399145_1122399158 22 Left 1122399145 14:101457400-101457422 CCGCCGTGGGGCGGGGGGTCCCA No data
Right 1122399158 14:101457445-101457467 CGCCTGCGGCATCAGCATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122399145 Original CRISPR TGGGACCCCCCGCCCCACGG CGG (reversed) Intergenic
No off target data available for this crispr