ID: 1122408997

View in Genome Browser
Species Human (GRCh38)
Location 14:101516690-101516712
Sequence GCCTCACATGGGGTGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122408997_1122409010 20 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409010 14:101516733-101516755 GGGACAGCAGGTTCCCTCCCAGG No data
1122408997_1122409007 -1 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409007 14:101516712-101516734 CCAAAGGAGCACAACGGGCATGG No data
1122408997_1122409005 -6 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409005 14:101516707-101516729 TGAGGCCAAAGGAGCACAACGGG No data
1122408997_1122409011 21 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409011 14:101516734-101516756 GGACAGCAGGTTCCCTCCCAGGG No data
1122408997_1122409004 -7 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409004 14:101516706-101516728 GTGAGGCCAAAGGAGCACAACGG No data
1122408997_1122409008 0 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409008 14:101516713-101516735 CAAAGGAGCACAACGGGCATGGG No data
1122408997_1122409009 8 Left 1122408997 14:101516690-101516712 CCAGCCCACACCCCATGTGAGGC No data
Right 1122409009 14:101516721-101516743 CACAACGGGCATGGGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122408997 Original CRISPR GCCTCACATGGGGTGTGGGC TGG (reversed) Intergenic
No off target data available for this crispr