ID: 1122409105

View in Genome Browser
Species Human (GRCh38)
Location 14:101517039-101517061
Sequence AAGGGGAAACAGAAGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409083_1122409105 28 Left 1122409083 14:101516988-101517010 CCCCTGCCCCTGCTGCGGCTCTG No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409093_1122409105 3 Left 1122409093 14:101517013-101517035 CCTAGGGACTTTCCCCAGCTCCC No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409084_1122409105 27 Left 1122409084 14:101516989-101517011 CCCTGCCCCTGCTGCGGCTCTGG No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409090_1122409105 20 Left 1122409090 14:101516996-101517018 CCTGCTGCGGCTCTGGGCCTAGG No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409099_1122409105 -10 Left 1122409099 14:101517026-101517048 CCCAGCTCCCTGGAAGGGGAAAC No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409086_1122409105 26 Left 1122409086 14:101516990-101517012 CCTGCCCCTGCTGCGGCTCTGGG No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409088_1122409105 22 Left 1122409088 14:101516994-101517016 CCCCTGCTGCGGCTCTGGGCCTA No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409098_1122409105 -9 Left 1122409098 14:101517025-101517047 CCCCAGCTCCCTGGAAGGGGAAA No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data
1122409089_1122409105 21 Left 1122409089 14:101516995-101517017 CCCTGCTGCGGCTCTGGGCCTAG No data
Right 1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409105 Original CRISPR AAGGGGAAACAGAAGAAGGG AGG Intergenic
No off target data available for this crispr