ID: 1122409427

View in Genome Browser
Species Human (GRCh38)
Location 14:101518394-101518416
Sequence GGCCTGGGACACACAGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409427_1122409436 3 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409427_1122409445 27 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409445 14:101518444-101518466 GACGGAAGGCCAGTGGGGACAGG No data
1122409427_1122409443 21 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409427_1122409444 22 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409444 14:101518439-101518461 TGGGTGACGGAAGGCCAGTGGGG No data
1122409427_1122409432 -5 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409427_1122409440 13 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409440 14:101518430-101518452 CGTGGCCTCTGGGTGACGGAAGG No data
1122409427_1122409437 9 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409427_1122409442 20 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409442 14:101518437-101518459 TCTGGGTGACGGAAGGCCAGTGG No data
1122409427_1122409435 2 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409435 14:101518419-101518441 TCTAACTGGCCCGTGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409427 Original CRISPR GGCCTGGGACACACAGAGTT GGG (reversed) Intergenic
No off target data available for this crispr