ID: 1122409432

View in Genome Browser
Species Human (GRCh38)
Location 14:101518412-101518434
Sequence AGGCCCATCTAACTGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409423_1122409432 1 Left 1122409423 14:101518388-101518410 CCCTTCCCCAACTCTGTGTGTCC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409422_1122409432 19 Left 1122409422 14:101518370-101518392 CCTATGATGGAGAGGAGACCCTT No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409419_1122409432 29 Left 1122409419 14:101518360-101518382 CCTGGGGTGCCCTATGATGGAGA No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409427_1122409432 -5 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409421_1122409432 20 Left 1122409421 14:101518369-101518391 CCCTATGATGGAGAGGAGACCCT No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409426_1122409432 -4 Left 1122409426 14:101518393-101518415 CCCCAACTCTGTGTGTCCCAGGC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409424_1122409432 0 Left 1122409424 14:101518389-101518411 CCTTCCCCAACTCTGTGTGTCCC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data
1122409428_1122409432 -6 Left 1122409428 14:101518395-101518417 CCAACTCTGTGTGTCCCAGGCCC No data
Right 1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409432 Original CRISPR AGGCCCATCTAACTGGCCCG TGG Intergenic
No off target data available for this crispr