ID: 1122409434

View in Genome Browser
Species Human (GRCh38)
Location 14:101518416-101518438
Sequence GAGGCCACGGGCCAGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409434_1122409443 -1 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409434_1122409442 -2 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409442 14:101518437-101518459 TCTGGGTGACGGAAGGCCAGTGG No data
1122409434_1122409444 0 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409444 14:101518439-101518461 TGGGTGACGGAAGGCCAGTGGGG No data
1122409434_1122409447 24 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409447 14:101518463-101518485 CAGGCGCAAGCACAGTGCAATGG No data
1122409434_1122409445 5 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409445 14:101518444-101518466 GACGGAAGGCCAGTGGGGACAGG No data
1122409434_1122409440 -9 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409440 14:101518430-101518452 CGTGGCCTCTGGGTGACGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409434 Original CRISPR GAGGCCACGGGCCAGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr